Plazminojenaktivatör inhibitor-1(PAI-1) 4g/5g gen değişiminin uzun yaşama etkisi
| dc.contributor.advisor | Akar, Nejat | |
| dc.contributor.author | Gülbahar, Z. Gülin | |
| dc.contributor.department | Biyoteknoloji | tr_TR |
| dc.date.accessioned | 2022-06-02T07:11:35Z | |
| dc.date.available | 2022-06-02T07:11:35Z | |
| dc.date.issued | 2010 | |
| dc.description.abstract | Studies related to longevity genes gained a new perspective with the ?damage due to response? theory in recent years. The most important of these in the theory formation are metabolic events. According to the theory, accumulation of damage process formed response. Genes that ensure genetic control in these mechanisms are called ?longevity genes?. Thrombosis is a disease that has a multifactorial nature. Although it is thought that Factor V 1691 mutation has the leading effect for thrombosis, there are many other genetic effects play role together. Previous studies indicate that the increased plasminogen activator inhibitor-1 levels in thrombosis patients, fibrinolytic activity is decreased. The increased PAI-1 plasma level is related with the 4G/5G insertion/deletion polymorphism that found 675 upstream of the transkription start sequence in the promoter region. In this content, the aim of this study is to search the effect of PAI-1 675 4G/5G insertion/deletion alone and in combination with FVL on longevity.The healthy and patient subjects were divided into mainly two groups, i.e. 1 to 18 years and 70 and older. Each group was also divided into two as thrombotic and non-thrombotic. Peripheral venous blood samples were collected and phenol- chloroform method was used to extract DNA. Analysis of PAI?1 4G/5G polymorphism was carried out by PCR with the forward 5?CACAGAGAGAGTCTGGCCACGT3?and reverse 5?CCAACAGAGGACTCTTGGTCT3? primers. The amplified 98/99 bp PCR products were controlled by running them on 3% agarose gel. BseLI restriction endonuclease enzyme used to detect 4G/5G polymorphism. band profiles were seen in the 7% polyacrylamide gel electrophoresis to detect gene variations.For the PAI-1 4G/5G gene variation, when 70 and older patients compared to healthy group 4G allele heterozoygosity is found to have has a protective role(OR:0.45, p:0.003). Homozygosity for 4G allele seen as also a protective factor for 70 and older patients groups(OR:0.50, p:0.03). Moreover 5G allele homozygosity is a risk factor for the disease with 1.98 odds ratio and 0.03 p-value. PAI-1 4G/5G gene variation in combination with FVL mutation also have protective role for 70 and older in case of 4G heterozygosity and homozygosity(p:0.004 OR:0.44, p:0.03 OR:0.48).It is observed that increased plasma PAI-1 activity responsible for decreased fibrinolytic activity for the individuals that escape from angina pectoris, diabetes, myocardial infarction. 4G/5G polymorphism is related to transcriptional activation changes in the PAI-1 gene. PAI-1 gene 4G motif is determined to has more transcriptional activity than 5G motif and in correspondence with the experimental results 4G allele homozygosity cause increased PAI-1 protein levels and activity than 5G allele. Some studies suggested that 4G allele that relates with increased PAI-1 levels is a sign of increasing thrombotic risks. As PAI-1 4G/5G poymorphism is thought to play a role in pathogenesis of the mentioned fatal diseases, it is considered that the survival of individuals can be affected by this gene variation. In the previous thesis study was done in our department, FVL mutation shown to be a risk factor for thrombosis after birth and have effects on morbidity. Therefore, FVL mutation are expected to shorten the life span. However, examined our DNA samples showed although some individuals carry FVL mutation, they were identified as long-lived. The contribution of the study hypothesis that FVL and PAI-1 4G/5G has a relation and by this relation 0-18 and 70 and over individuals been included in the study, as a result it is determined that, 4G allele found to have a protective role for the eldery group whereas 5G allele is a risk factor for the disease.Key words: Thrombosis, PAI-1 4G/5G ins/del, FV1691 G-A, Longevity Genes | tr_TR |
| dc.description.ozet | Son yıllarda uzun yaşam genleriyle ilgili çalışmalar, ?hasara karşı gelişen cevap? teorisinin de ortaya konulmasıyla farklı bir boyut kazanmıştır. Hasar yaratabilecek oluşumlardan bu teoride yer alanlardan en önemlisi metabolik olaylardır. Teoriye göre meydana gelen hasarlarla oluşan birikime karşı yanıt oluşumu gerçekleşmektedir. Bu mekanizmada genetik kontrolü sağlayan genlere ?uzun yaşam genleri? denilmektedir. Tromboz multifaktöriyel nitelikte bir hastalıktır. Faktör V molekülünde 1691 nükleotid pozisyon mutasyonun tromboz oluşumunda en çok etkisi olduğu düşünülse de tromboz oluşumunda birçok kalıtsal etki birlikte rol oynar. Daha önce yapılan çalışmalar ışığında tromboz hastalarında artan plazminojen aktivator inhibitörü-1 (PAI-1) seviyeleri sonucu fibrinolitik aktivitenin azaldığı belirtilmiştir. PAI-1 artan plazma seviyesi ise genin promoter bölgesinin transkripsiyon başlama sekansından 675 baz çifti yukarıda görülen 4G/5G insersiyon/delesyon polimorfizmiyle ilişkilendirilmiştir. Bu bağlamda çalışmanın amacı, PAI-1 675 4G/5G insersiyon/delesyon gen değişiminin tek başına ve FVL mutasyonu ile birlikte uzun yaşam açısından etkisinin araştırılması olarak belirlenmiştir.Tromboz tanısı olan bireyler ve olmayan sağlıklı bireyler, 0-18 ve 70 yaş üstü olmak üzere çalışma gruplarını oluşturmaktadır. Bireylerden alınan kan örneklerinden Fenol-Kloroform yöntemiyle DNA izolasyonu gerçekleştirilmiştir. PAI-1 4G/5G gen değişimi için F:5'-CACAGAGAGAGTCTGGCCACGT-3' ve R:5'-CCAACAGAGGACTCTTGGTCT-3' primerleri ile polimeraz zincir reaksiyonu (PCR) yöntemi kullanılarak PAI-1 promotor bölgenin çoğaltılması sağlanmıştır. Elde edilen 98/99 bç'lik PCR ürünleri %3'lük agaroz jelde yürütülerek Polimeraz Zincir Reaksiyonu ile çoğaltılan bölge kontrol edilmiştir. İlgili gen değişimini saptamak için BseLI restriksiyon endonükleaz enzimiyle kesim yapılmıştır. %7'lik Poliakrilamid Jel Elektroforezi ile bant farklılıkları saptanarak gen değişimleri tespit edilmiştir.Plazminojen aktivator inhibitor 4G/5G gen değişimi açısından 70 yaş üstü hasta ve sağlıklı bireyler karşılaştırıldığında, 4G alelinin heterezigot olarak bulunması durumunda koruyucu faktör rolü olduğu bulunmuştur (OR:0.45, p:0.003). 4G alelinin homozigot olarak bulunduğu durumda yine 70 yaş ve üstü grupta koruyucu faktör olarak belirlenmiştir (OR: 0.50, p: 0.03). 5G aleli homozigotluğunda ise 1.98 risk faktörü ve 0.03 p-değeri ile 70 yaş ve üstü grupta hastalık için risk faktörü olarak tespit edilmiştir. FVL mutasyonu açısından 70 yaş üstü grupta PAI-1 4G/5G gen değişimine bakıldığında, 4G aleli heterozigotluğunun ve homozigotluğunun yine koruyucu faktör rolü üstlendiği bulunmuştur (p:0.004 OR:0.44, p:0.03 OR:0.48).Artan plazma PAI-1 aktivitesinin kalp spazmı, diyabet ve miyokard infarktından kurtulan bireylerde azalmış fibrinolitik aktiviteden büyük ölçüde sorumlu olduğu gözlenmiştir. 4G/5G polimorfizmi PAI-1 geninin transkripsiyonel aktivasyonundaki değişimler ile ilişkilendirilmektedir. PAI-1 genindeki 4G motifinin varlığı 5G motifinin varlığından daha fazla transkripsiyonel aktiviteye neden olduğu belirlenmiş ve bu deneysel sonuçlarla paralel olarak 4G allelinin homozigot durumda olması plazma PAI-1 protein seviyeleri ve aktiviteleri bakımından 5G alleline göre daha yüksek olduğu sonucunu doğurmuştur. Bazı çalışmalar, 4G alellenin yüksek PAI-1 seviyeleriyle ilişkilendirilmesini trombotik risk artışının bir habercisi olduğunu öne sürmüşlerdir. PAI-1 4G/5G polimorfizminin yukarda sayılan ölümcül hastalıkların patogenezinde rol oynayabileceği düşünüldüğünden, bireylerin uzun yaşamasının da bu gen değişiminden etkilenebileceği düşünülebilir. Daha önce bölümümüzde yapılan tez çalışmasında FVL mutasyonunun doğumdan itibaren tromboz açısından risk faktörü olduğu ve morbiditeye etkisi olduğu gösterilmişti. Bu nedenle FVL mutasyonunun yaşam süresini kısaltması beklenmektedir. Ancak, elimizdeki DNA örneklerine bakıldığında bazı bireylerin FVL taşımalarına rağmen uzun yaşamakta oldukları belirlenmiştir. Bu çalışmanın sonuçlarından hipotezlenen FVL ile PAI-1 4G/5G arasındaki ilişkiden yola çıkarak, 0-18 ve 70 yaş üstü bireyler çalışmaya dâhil edilmiş ve 4G alelinin yaşlı grupta koruma rolü, 5G alelinin ise hastalık için risk faktörü rolü olduğu tespit edilmiştir.Anahtar kelimeler: Tromboz, PAI-1 4G/5G ins/del, FV1691 G-A, Uzun Yaşam Genleri | tr_TR |
| dc.identifier.uri | http://hdl.handle.net/20.500.12575/80843 | |
| dc.language.iso | tr | tr_TR |
| dc.publisher | Biyoteknoloji Enstitüsü | tr_TR |
| dc.subject | Plazminojenaktivatör inhibitor-1 | tr_TR |
| dc.subject | gen değişimi | tr_TR |
| dc.title | Plazminojenaktivatör inhibitor-1(PAI-1) 4g/5g gen değişiminin uzun yaşama etkisi | tr_TR |
| dc.title.alternative | Effect of PAI-1 4g/5g gene variation on longevity | tr_TR |
| dc.type | masterThesis | tr_TR |